These studies were performed in accordance to the NIH GUIDE TO THE CARE AND USE OF LABORATORY ANIMALS and the Animal Welfare Act in an AAALAC-accredited program.

Male Hartley Short Hair guinea pigs (350 – 400 g) were euthanized with CO₂, and the nodose ganglia were dissected and flash-frozen in liquid nitrogen prior to total RNA isolation. Total RNA was prepared from nodose ganglia using the Ambion Totally RNA kit (Ambion, Austin, TX, USA) according to the manufacturer's instructions. First strand cDNA synthesis was carried out and used to carry out PCR reactions using an Ex Taq Kit (Pan Vera, Madison, WI, U.S.A.). Multiple primers were designed based upon the published guinea pig sequence (GenBank #AJ492922) and used to generate short fragments for establishment of a consensus sequence. The resulting full length sequence (GenBank #AY729017) was used to clone a full length gpTRPV1 sequence from primary tissue. The following primers were used to clone out gpTRPV1 in two fragments P1:atgaagaaacgggctagtgtgg, P2: gccagagccagtggtgtgaaccccttc, P3:gaaggggttcacaccactggctctggc, P4: tcacttctcccctggaactgtcggactc. The resulting fragments were used to create a full length gpTRPV1 cDNA sequence which was subcloned between the NotI and EcoRV sites of the pTRE2hyg vector (BD Biosciences, Clontech, Palo Alto, CA) for sequence confirmation and Tet-promoter controlled expression of gpTRPV1. Stably-transfected HEK293Tet^OFF cells expressing gpTRPV1 under control of the Tet-promoter were maintained in MEM medium (supplemented with 10% Tet System Approved FBS/penicillin/streptomycin/L-glutamine/geneticin G418, all from Invitrogen, Caisbad, CA) at 37°C and 5% CO₂ in a humidified atmosphere.

Analysis of gpTRPV1 activity was carried out using FLIPR as described previously 26. Briefly, HEK293^OFF cells stably-expressing gpTRPV1 were plated in black clear-bottomed 96-well poly-lysine plates (BD Biosciences) at a concentration of 40,000 cells per well in 200 μl of media in the absence of doxycycline to allow for expression. The plates were incubated for two days at 37°C and 5% CO₂ to allow for optimal expression of TRPV1. The cells were incubated in a buffer consisting of Hank's Balanced Salt Solution (HBSS) containing 10 mM HEPES pH 7.4, BSA 1%, and probenecid 2.5 mM with the addition of the calcium sensitive fluorescent dye Fluo-4AM (Molecular Probes, Eugene, OR) (4 μM) for 1 hour at 37°C. The cells were washed 3 times with the above buffer, which had been heated to 37°C. A total of 100 μl of buffer was placed in to each well and the plates were put in a 37°C incubator for an additional 30 minutes prior to assay. All compounds used in these studies were dissolved in dimethyl sulfoxide (DMSO) and vehicle alone (DMSO) was used as a control. The cells were then placed in a FLIPR (Molecular Devices, Sunnyvale CA) with a heated stage maintained at 37°C for monitoring changes in fluorescent signal upon addition of agonist. After addition of compound, change in fluorescence was monitored for a period of 5 min and maximal increase in fluorescent signal was noted. Antagonist was added to cells in a volume of 50 μl via the FLIPR and allowed to incubate for 6 minutes prior to addition of agonist. The change in fluorescence (max – min) upon addition of agonist was used to assess activation.

Male Hartley guinea pigs (600 – 700 g, Charles River, Bloomington, MA, USA) were euthanized with CO₂. The nodose ganglia were removed under aseptic conditions and enzyme digested as previously described 17. Briefly, the isolated ganglia were washed in Hank's buffer (Gibco, NY, USA) and then transferred to Hank's buffer containing collagenase (type IA, 1 mg • ml^-1) for 45 min at 37°C in a water bath. The enzyme solution was aspirated from the tissues, after which they were rinsed with Hank's buffer and then incubated in Hank's buffer containing DNAse IV (0.1 mg • ml^-1) for 15 min at 37°C in a water bath. Tissues were washed with Hank's buffer and subjected to gentle trituration using a Pasteur pipette. The resulting cell suspension was filtered through a sterile nylon mesh (Becton Dickinson Labware MA, USA) and plated into poly-lysine coated petri dishes (Becton Dickinson Labware MA, USA). Cells were incubated for 3 hrs at 37°C prior to the intracellular Ca²⁺ measurements. Intracellular Ca²⁺ concentrations in single nodose ganglia cells was measured in Hank's buffer using Attofluor digital ratiovision system (Atto Instrument, Maryland, USA). Briefly, cells were incubated with Fura-2 acetoxy methylestor (5 μg ml^-1, Molecular Probes), a calcium sensitive fluorescence dye, in HBSS containing 0.4% bovine serum albumin (BSA) for 45 min at 37°C. The dye-loading solution was removed and the cells were washed three times with HBSS containing 0.4% BSA. Fluorescence in single cells was measured at a single emission wavelength (510 nm) with double excitatory wavelength (334 and 380 nm), using Attofluor digital ratiovision system. Intracellular Ca²⁺ concentration was estimated by ratio of fluorescence at excitation wavelengths of 334 and 380 nm. Capsaicin responses were elicited by direct additions to the cell culture buffer during real-time recording

All cough experiments were performed in conscious guinea pigs (Male Hartley, 400 – 500 g, Charles River, Bloomington, MA, USA) using methods described by Bolser et al., 20. In the first experiment, the effect of graded concentrations of aerosolized capsaicin was examined on cough frequency. Overnight fasted guinea pigs were placed in a 12 × 14-inch chamber and exposed to aerosolized capsaicin (10 – 300 μM, for 4 min) produced by a Ultra-NeB 99 Devilbiss nebulizer (Somerset, PA) to elicit cough. Experiments were conducted in a parallel design where each animal was exposed only once to capsaicin. The number of coughs were detected by a microphone placed in the chamber and verified by a trained observer. The signal from the microphone was relayed to a polygraph that provided a record of the number of coughs. The antitussive activity of BCTC was determined against cough provoked by capsaicin (300 μM). In these studies, BCTC (0.01 – 10 mg/kg, i.p.) was given 30 minutes before capsaicin challenge. In a separate study, the cough suppressant effects of BCTC (0.03 and 3.0 mg/kg, i.p.) was studied at 1 hour after i.p. administration.

Male Hartley guinea pigs (300 – 350 g, Charles River, Bloomington, MA, USA) were actively sensitized to ovalbumin over a 27 day regimen. On day 1, animals were administered ovalbumin (100 μg, i.p.) and aluminum hydroxide (200 mg, i.p.) suspended in 0.5 ml of water. On day 7, animals were administered an additional dose of ovalbumin (100 μg, i.p.). The animals were used 27 days after the initial ovalbumin dose when they weighed between 450 – 500 g. Allergic cough studies were performed in an exposure chamber similar to the one used to examine capsaicin-evoked cough responses. The concentration of ovalbumin (0.3%) used to elicit cough was selected based on studies by Bolser et al., 20. BCTC (1 and 3 mg/kg, i.p.) was given 30 minutes before ovalbumin (0.3%). The activity of a second TRPV1 antagonist was also studied in these experiments, capsazepine (300 μM; 4 min aerosol) was given 4 minutes before antigen challenge.

Data from HEK293^OFF cells studies are presented as the percentage of the maximal response for each agonist. Calculation of IC₅₀ values were determined using GraphPad Prism v3.02 (GraphPad Software, Inc.). Data from the cough studies are expressed as cough number due to either a capsaicin or a ovalbumin 4 minute exposure. Values displayed in the figures represent the MEAN ± SEM of 6–12 animals per group. Data were evaluated using a non parametric Kruskal Wallis in conjunction with a Mann Whitney U. Statistical significance was set at p < 0.05.

Capsaicin, capsazepine, and phorbol 12-myristate 13-acetate (PMA) were purchased from Sigma (St. Louis, MO, USA). N-(4-Tertiarybutylphenyl)-4(3-cholorphyridin-2-yl)tetrahydropyrazine1(2H)-carbox-amide (BCTC) was synthesized based on to published reports and was tested in all experiments as the free base (molecular weight 372.89) 24. For molecular and in vtiro studies drugs were dissolved in dimethylsulfoxide (DMSO) and stored at -20.0 °C. The final concentration of DMSO was less than 0.1% (v/v) in these studies. For in vivo studies, capsaicin and capsazepine were dissolved in 10% ethanol and physiological saline (0.9%), respectively. BCTC was dissolved in warm (58°C) 45% (2-hydroxypropyl-) β-cyclodextrin.

The TRPV1 antagonist BCTC was tested for its ability to inhibit various modalities of guinea pig TRPV1 activation. BCTC dose-dependently inhibited capsaicin-induced activation and PMA-mediated activation of guinea pig TRPV1 with IC₅₀ values of 12.2 ± 5.2 nM, and 0.85 ± 0.10 nM, respectively (see Figure 1A). The addition of 50 nM PMA to gpTRPV1 expressing cells which were pre-incubated with 1 μM Ro 31–8220, a PKC inhibitor, elicited no response (data not shown). Additionally, capsazepine was able to block both modes of TRPV1 activation with potencies relative to previously described results 27. The inclusion of 100 nM BCTC completely blocked the ability of gpTRPV1 to respond to decreases in pH (see Figure 1B).

Previously we have shown that capsaicin increases intracellular Ca²⁺ in guinea pig nodose ganglia cell, in a concentration-dependent manner 28. In the present study we evaluate the activity of BCTC against the increase in nodose intracellular Ca²⁺ elicited by 0.1 μM capsaicin. The change in the 334/380 fluorescence ratios due to capsaicin (0.1 μM) was 2.08 ± 0.26. BCTC (1 × 10^-9 – 1 × 10^-7M) significantly attenuated capsaicin-induced intracellular Ca²⁺ responses in nodose ganglia cells (see Figure 2).

In non-sensitized naive animals, aerosolized exposure to capsaicin (10–300 μM) increased guinea pig cough frequency (see Figure 3). In follow-up studies we used the 300 μM concentration of capsaicin as the provocation dose to examine the cough suppressant activity of BCTC. Capsaicin (300 μM) produced 15.6 ± 2.1 coughs over a 4 minute exposure time (see Figure 4). Figure 4 shows that 30 minutes after i.p. administration BCTC (0.01–3.0 mg/kg, i.p.) dose dependently attenuated the increase in cough frequency provoked by capsaicin (300 μM). We found that the optimum experimental protocol for the BCTC cough studies was to give the drug i.p. 30 minutes before capsaicin, because by 60 minutes the cough suppressant activity of BCTC was significantly diminished (see Figure 4). Using the experimental design established in the capsaicin studies, BCTC (3 mg/kg, i.p.) was administered in sensitized guinea pigs 30 minutes before cough was provoked by ovalbumin. BCTC inhibited allergic cough by 60% (see Figure 5). Doses of BCTC greater than 3 mg/kg could not be tested because of solubility limitations of the drug. To confirm the antitussive actions of BCTC against antigen-induced cough, a structurally different TRPV1 antagonist was also studied. Similar to BCTC, aerosolized capsazepine (300 μM) blocked cough (-81%) elicited by ovalbumin (See Figure 5).